dayshawn120799 dayshawn120799

10-01-2023
Biology

contestada

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

Respuesta :

Otras preguntas

Behavioral Adaptations: Behavior that animals begin life with that helps them meet their needs is called ________.

Why does scaring someone get rid of hiccups?

Average world grain production increased from 247 kg per person in 1950 to 342 kg per person in 1984. Given this information, calculate the average increase per

A boat costs $19,200 and decreases in value by 12% per year. How much will the boat be worth after 5 years?

I Need Help Please Kate has some dimes and quarters. If she has 32 coins worth a total of $5.30, how many of each type of coin does she have

Aristotle,one of the first scientists to group organisms,grouped animals according to what way?

The battles in the revolutionary war and the blanks aren't filled.

what were the patriots concerned about when the war was over and they had won

This polygon has only 4 sides no Congruent sides no right angles and no pairs of parallel sides who am I

Fill the blanks please! Due tomorrow