ailani9 ailani9

06-06-2023
Biology

contestada

A substitution mutation occurred and changed the 5th base in the DNA from a C to a T. Write the sequence of RNA codons that would result from this kind of mutation. **Separate each codon with a space. TACACGCAATTACCAGGGTAGCCATTGATT

Respuesta :

Otras preguntas

Why the mechanical wave need a medium to propagate?

Which inequality represents all values of x for which the product below is defined? √5x ·√x+4 a.x>0 b.x≥0 c.x≤-4 d.x≥-4

When do you think that the Silver American Eagle will peak again, like it did in 2011? Do you think it would go back up? And how much do you think it will be wo

Name the organelle of plant cells in which photosynthesis occurs

Which number is equivalent to 16? A.256 B226. C.32 D.18 What value of x makes the equation below true? 7x-1=9 A.2/7 B.8/7 C.10/7 D.16/7

a sphere has a volume of 4500pi cubic inches. find the surface area of the sphere.

The basic building blocks of lipids include (a) amino acids only. (b) fatty acids and amino acids. (c) fatty acids and glycerol. (d)

differentiate between roughage and concentrate

Find the distance between the pair of parallel lines, y = -2x+1 & y = -2x+16.

why it is advise to clean the ends of connecting wires before connecting them?