TheLegendYT TheLegendYT

11-01-2024
Biology

contestada

This is a question about Biology, I need help
Pls answer the Best as you can

Write the base pairs that go on the opposite strand
BUILD A DNA STRAND
(remember the base pairs)

TTAAGCGGTTAAGCATTGCGGGCAAT

Respuesta :

Otras preguntas

what is a complementary angle to 27 degrees

Carolyn has been contributing to a pre-tax retirement account. Her youngest child is ready to start college, and Carolyn wants to withdraw $61,671.71 from the a

Given that y varies directly with x, find the equation of direct variation. x is 14 when y is 12

If you had only one match and entered a dark room containing an oil lamp, some kindling wood, and a newspaper, which would you light first? TRICK QUESTION (Plea

three reasons why germany was responsible for ww1

...........................................................................

Explain a strategy you could use to compare 2/8 and 5/8

how does dissolved oxygen levels in the water effects kelp?

Monomers are small, individual molecules that are used to build larger molecules. Polymers are large organic molecules that are built from monomers. What type o

1 the ___________ membrane separates the outer from the middle ear. 2 the ____________ is where sound is turned into nerve messages. 3 the ____________ are th