Sambbunz4748 Sambbunz4748
  • 16-01-2024
  • Physics
contestada

The cat accelerates at a rate of 1.5 m/s for 10 seconds. What is the cat's final velocity after the 10 seconds?
a. 10 m/s
b. 15 m/s
c. 25 m/s
d. 30 m/s

Respuesta :

Otras preguntas

What is a possible value of sin(theta) when cos2(theta)=0.73?a.0.37b.0.63c.0.26d.0.74
What is the angle of reflection?Question 2 options:the angle that the reflected ray makes with the incident raythe angle the reflecting surface makes with the g
1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
I will mark brainiest is my answer is right?
Please help asap! 44 pts (:
Manuel is filling water balloons at a constant rate of 3 water balloons per minute. With the given information, which of these statements is a reasonable conc
what do acids release in water ?
What does gatsby tell nick about himself? aside from the improbability of his story, what other evidence is there that gatsby is lying about something when he t
In the “Monkeys Paw” the author uses both actions and words of the sergeant major to build suspense. Describe how both the words he says and the actions he tak
Which element in southeast desert ecoystembl is abiotic