Stario8868 Stario8868

09-02-2024
Biology

contestada

The information about the plant specimens in the herbarium compiled and published in a book form is known as
A Flora
B Fauna
C Herbarium
D Catalogue

Respuesta :

Otras preguntas

Which is not an example of a supporting detail? topic sentence description illustration fact

1Getting out of bed is the first goal I tackle each day. 2Several small goals are achieved by me as the day progresses. 3When I am riding the bus home or walkin

Which of the following marked the official end of the American Revolution?

What to do most careers in Finance deal with? A) real estate and education B) assets and liabilities C) assets and retail D) real estate and retail

What is an example of a nonmotile protist?

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Do metamorphic rocks form above ground or below ground?

Evaluate g(4): g(x)=8x^2+9x-7 A. 121 B. 135 C. 154 D. 157

Write 6x6x6x6x6 in exponential form

Explain how neuroscientist study the brains connection to behavior and the mind