NatalieAllen11 NatalieAllen11

08-05-2018
Physics

contestada

What is the composition of Level C in a soil profile

A. Topsoil mixed with inorganic material.

B. Clay and slit mixed with sand

C. Decayed organic material.

D. Weathered rock fragments

Respuesta :

kiseracademy201 kiseracademy201

08-05-2018

I believe your answer D, level C is the parent material level, hope this helped!

Answer Link

JemdetNasr JemdetNasr

20-08-2018

The correct choice is

D. Weathered rock fragments

Answer Link

Otras preguntas

Describe the difference in the purpose and naming process of a criminal case and a civil case.

Sue was given a gift card for her birthday. When deciding how to spend it, Sue will try to _____. minimize benefits maximize satisfaction increase marginal cos

PLEASE HELP!!! What was the purpose of the Taft-Hartley Act? And what do the acts contain ?

The following sentence is an example of: Luisa estaba cantando cuando llego Carlos a su casa A. Imperfecto Progresivo B. Pretérito C. Verbos Regulares D. Pr

1) One chicken is able to lay 1.5 kg of eggs in one month. How many kilos will 3 chicken be able to lay in 10 months?

Where does most of the glucose come from that most organisms use to make atp?

Find the slant height of this square pyramid.

how did the berlin conference illustrate eurocentrism

in what way is a screw similar to an inclined plane?

To which of the following DNA sequences would the TATA box binding protein bind? A. TAGGCGTATATAGCGCCTTAT B. CCCGTTAATTAATTAACGCGC C. GCGCTTATCTATTACCGTACG D