contestada

The sequence of this single strand of DNA is ATTCGGCTATTTACGATTGCCAT. To complete this model, what should the nucleotides on the other strand be? Start with the top of the strand and work down.

Respuesta :

MelaniaLateefa
TAAGCCGATAAATGCTAACGGTA
samueladesida43

The nucleotides sequence on the other strand will be as follows: TAAGCCGATAAATGCTAACGGTA

DNA:

  • DNA is a biological molecule that stores genetic information in living organisms.

  • The DNA molecule is made up of monomers called nucleotides, which are four in number as follows: Adenine (A), Cytosine (C), Guanine (G) and Thymine (T).

  • In the DNA molecule, A pairs with T while G pairs with C. In a single strand DNA sequence given as follows: ATTCGGCTATTTACGATTGCCAT, the sequence of nucleotides on the other side of the strand will be TAAGCCGATAAATGCTAACGGTA.

Learn more at: https://brainly.com/question/24164081?referrer=searchResults