ghunderman24 ghunderman24
  • 09-01-2019
  • Chemistry
contestada

What is the complementary DNA strand for the following sequence:
ATGGCTTGCCAAGGTCCGGAAACTTTG

Respuesta :

alexandraderigg
alexandraderigg alexandraderigg
  • 09-01-2019
TACCGAACGGTTCCAGGCCTTTCAAAG
Answer Link

Otras preguntas

In America, the main influence of the Enlightenment was expressed through
Gabrielle's age is three times Mikhail's age. The sum of their ages is 56, what is their age?
15/18 + 1/2 - 1/3 - 2/6=
15/18 + 1/2 - 1/3 - 2/6=
Factor 9x^3y-25xy^3 completely.
a washer and a dryer cost 659$ combined. The washer costs 91$ less than the dryer, how much was the dryer?
Water that flows downhill along Earth's surface is called
Unlike prokaryotic cells, eukaryotic cells have the ability to
You are booking a flight from New York to Atlanta. There is no change in the time zones. The flight leaves New York at 11:15 a.m. and arrives in Atlanta at 1:45
a washer and a dryer cost 659$ combined. The washer costs 91$ less than the dryer, how much was the dryer?