arleth714 arleth714

08-05-2019
Biology

contestada

What has to happens in order to natural selection to occur

Respuesta :

startaye500 startaye500

08-05-2019

natural selection is an species wich are adapted to their environment

Answer Link

Otras preguntas

CALIBAN . . . When thou camest first, Thou strokedst me and madest much of me, wouldst give me Water with berries in't, and teach me how To name the bigg

if a rock disintergrates by chemical weathering into small grains of compostion would it be consdered reproduction

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

According to historians, from which region did the early humans migrate to the Americas? A. Scandinavia B. Siberia C. Indonesia D. Transylvania

Two functions, A and B, are described as follows: Function A y = 8x + 3 Function B The rate of change is 1 and the y-intercept is 4. How much more is the rat

If an interest inventory reveals that you are highly interested in solitary, introverted work, what might be the best type of career for you? ballerina business

Select the appropriate correction to the following sentence: You shouldn't pat a strange dog, sometimes they're not friendly. Select one: a. You shouldn't pa

Which four organizations opposed the use of violence in the struggle for African American civil right?

What protects the plant embryo?

A carnival game has 160 rubber ducks floating in a pool. The person playing the game takes out one duck and looks at it. If there’s a red mark on the bottom of