roxaneelove roxaneelove

07-06-2016
History

contestada

Which of the following was an important development that characterizes the Neolithic Era?Help Please :/ Thank you!! :) Any Help Is Appreciated.

-A) Isolation of communities from outsiders

- B)Development of stone weapons and tools

- C)Seasonal migration of human populations

- D)Development of unequal social classes

Respuesta :

08-06-2016

B. Development of stone weapons and tools

Answer Link

mangledavy101pdrmkd mangledavy101pdrmkd

03-10-2018

your answer would be B

Answer Link

Otras preguntas

One of the main themes in this book is the appeal of the wild. It draws in Buck, and it draws in the reader. Eventually, you will write a longer story about the

100 POINTS!!!! Read the excerpt below and then select one prompt. You will choose to write either a narrative essay or an informational response paragraph. The

what is the volume of a cube if s =8

A cornfield include corn plants my socks and various insects fungi and bacteria which nutritional role is correctly paired with organisms that carry out that ro

An object falling straight down without air resistance is said to be exhibiting A. free fall B. projectile motion C. circular motion D. two-dimensional motion

Prudence, indeed, will dictate that Governments long established should not be changed for light and transient causes; and accordingly all experience hath shewn

You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA Wha

What type of reaction is the following chlorine + potassium nitride - nitrogen + potassium chloride

what is the common difference of the following sequence? 4.3,5,7,9,11___5.16,19,22,25__

If each fish tank has a volume of 3 ft ³ and there are 20 tanks, what is the total volume of all the tanks?