kyleadler0807 kyleadler0807

07-12-2019
Biology

contestada

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

Respuesta :

Milliecartier Milliecartier

07-12-2019

Answer:

5'UUA GCA AAG CUU GUG GCA UG'3

Explanation:

6 amino acids

Splitting the sequence into its codons, there are 6 codons and hence this sequence would code for 6 amino acids.

Answer Link

Otras preguntas

You have 60 feet of fencing to create a rectangular garden. One side of the garden will be against an existing shed, so that side does not require fencing. Dete

The temperature rose 6.4 Fahrenheit between noon and 5 PM and fill 34.7 Fahrenheit from 5 PM to 10 PM if the temperature at noon is 17.7 Fahrenheit what will th

A crate of mass 9.2 kg is pulled up a rough incline with an initial speed of 1.42 m/s. The pulling force is 94 N parallel to the incline, which makes an angle o

H2SO4(aq)+LiOH(aq)→ Express your answer as a chemical equation. Identify all of the phases in your answer. Enter noreaction if there is no reaction.

What's a device that minimizes heat transfer?

When employers are first looking to hire students who are graduating college, employers frequently look for graduating students, who demonstrate they take their

Acme Home Lending offers home equity loans up to 80% of the home value for its customers. If Sally Johnson has a home valued at $200,000 and a current mortgage

Hydrogen sulfide (H2S) is a common and troublesome pollutant in industrial wastewaters. One way to remove H2S is to treat the water with chlorine, in which case

how did the California gold rush transform the west in the American imagination ?

Steven has $25 dollars to spend. He spent $10.81, including tax, to buy a new DVD. He needs to save $10.00 but he wants to buy a snack. If peanuts cost $1.38 pe