aryanamunoz04 aryanamunoz04

14-04-2020
Biology

contestada

A restriction enzyme is coded for: AT!GC

How long would the Base Pair fragments be for this DNA sequence?

AGTCGAGTATATGCATGGCCGCGAT

1)25 and 0
2)25 and 25
3)14 and 11
4)12 and 13

Respuesta :

exspressgirl27oz2xjv exspressgirl27oz2xjv

21-04-2020

Answer: The answer is 4) 12 and 13

Explanation: you count the A and T together, which is 12. Then you count the G and C together, which is 13. I just took a test with this question and got it correct

Answer Link

Otras preguntas

HELP ME Compare and Contrast Electromagentic and Gravitational force. You need to provide two ways that they are alike and two ways that they are different.

Helen is organising a party and she needs party plates and straws their 30 party place in a pack there are 120 straws in a pack she needs exactly same number of

simplify 10+6/2+3 A.16/5 B. 3 C. 7 D. 11/3

Although most international business is conducted in English, levels of comprehension can vary. How can you enhance your oral communication skills in internatio

what is the purpose of a punnet square

The city council of a small town needs to determine if the town's residents will support the building of a new library. The council decides to conduct a survey

If f and t are both even functions, is the product ft even? If f and t are both odd functions, is ft odd? What if f is even and t is odd? Justify your answers.

find the coordinates of the midpoint of the segment with the given endpoints. Y(-13,8) and Z (2,-10)

write equations as sentence 9+x=10

Tom has 2 more than 5 times the number of CD’s that Jane has. Jane has 5 CD’s. Write an expression to express this.