stefanieloney stefanieloney

14-04-2020
Biology

contestada

A restriction enzyme is coded for: AT!GC

How long would the Base Pair fragments be for this DNA sequence?

AGTCGAGTATATGCATGGCCGCGAT

Question 1 options:

14 and 11

12 and 13

25 and 0

25 and 25

thanks

Respuesta :

exspressgirl27oz2xjv exspressgirl27oz2xjv

21-04-2020

Answer:the answer is 12 and 13

Explanation: You count the A and T together, which is 12, then you count the G and C together which is 13. I just took this on my test and got it correct

Answer Link

Otras preguntas

A ball whose density is 0.4 × 10³ mg / m 3 falls into water from a height of 9 cm. To what depth does the ball sink?A. 6 cmB. 9 cmC. 4.5 cmD. 2.25 cm.

Connecting host computers and their networks together to form even larger networks is called:A. QueuingB. Data miningC. Ethernet framingD. InternetworkingE. Net

An electric dipole consisting of charges of magnitude 2.10 nC separated by 6.6 µm is in an electric field of strength 1100 N/C. What are the magnitude of the el

What brought about a new wave of sympathy for the plight of women in the garment industry in Lawrence, Massachusetts? a) Labor strikes b) Government interventio

AI derived business value will more than triple. True or False?

What do these two changes have in common, water evaperating from a lake and beating an egg?

The scientist wants to make changes to the container that will allow the container to have some liquid water, some ice, and some water vapor at the same time. W

What does Kisa Gotami understand the second time that she failed to understand the first time?

What should be the foundation of all valid/true concepts?

To keep the food safe during holding and serving, you must know how to hold hot and cold food; use time as a method of control to hold food; and prevent contami