Seudónimo Seudónimo

07-05-2020
Mathematics

contestada

Help again. due today so help me

Help again due today so help me class=

Respuesta :

playzpearl playzpearl

07-05-2020

Answer:

32 sq. units

Step-by-step explanation:

Using the formula for the area of triangle hb/2 the area can be found. The vertical side is the height h and the horizontal side is the base b. Each side has a length of 8 units.

Hope this helps!

Answer Link

Otras preguntas

Please match the term to its definition, below. These are single, standalone terms which encapsulate the main ideas of your research topic. One example of this

Vinblastine, a drug that inhibits microtubule polymerization, is used to treat some forms of cancer. Cancer cells given vinblastine would be unable to _____.

Munwar and Jackson both work as logistics supervisors at a successful restaurant management company. Recently, the manager for District G retired and both Munwa

Past tense, what is the past tense of these? ¿Qué ______________ (HACER) tú ayer? Tú _____________ (TOMAR) dos clases ayer, ¿no? Tú ____________ (COMER) una ens

If a person is making the maximum salary for a construction worker, they are making more than what percentage of Teachers?

A statute enacted by the Arizona state legislature to regulate trucking affects interstate commerce. In evaluating this statute, the courts will balance the bur

The research conducted by _____ to determine the characteristics of successful organizations was later criticized during the 1980s.

A restaurant charges $10 for a medium pizza and $1 for each topping what is the proportion

Although labor is typically viewed as a variable cost in the very short run, some labor costs may be fixed. Which of the following items represents an example o

How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10