sadeelby73 sadeelby73

06-06-2020
Mathematics

contestada

William’s salary is £24 000
His salary increases by 4%.
Work out William’s new salary.

£ ............................

Respuesta :

00001050 00001050

06-06-2020

His new salary is £24960

24000 x 0.04 = 960
24000 + 960 = 24960

Answer Link

Otras preguntas

What is the maximum number of amino acids in a peptide that would be produced from the following mRNA sequence: 5′ AAUCCGUAAAUGAGACCGUCGAUCAAUUAGCG 3′?

Unit of Length Customary System Units Metric System Units 1 inch 2.54 cm 1 foot 0.3048 m 1 mile 1.61 km. What is the conversion factor to convert kilometers to

Comen todas estas postres. correct incorrect

Some digestive products, such as water and electrolytes, will be absorbed by diffusion. They diffuse from an area of ____________ concentration in the intestina

Your friend Heidi talks a lot, often ignoring what you have to say; in fact, she regularly focuses the conversation on her issues, problems, and interests. What

If Lucy Hale (star of Pretty Little Liars) appears on Good Morning America and talks about her upcoming album and how great it is going to be, the viewing audie

May I get some help pls?

When conducting training on how to use a new copier, Ben begins by teaching trainees how to reduce and collate copies. What problems do you see with his trainin

You buy land in the tropics on steep mountain slopes covered by large trees and deep soil. You want to build a house on the land. Which of the following buildin

The staff training center at a large regional hospital provides training sessions in CPR to all employees. Assume that the capacity of this training system was