astarok65
astarok65 astarok65
  • 09-09-2020
  • Mathematics
contestada

Helppp please! Find the value of cos X

Helppp please Find the value of cos X class=

Respuesta :

Hrishii
Hrishii Hrishii
  • 09-09-2020

Answer:

3/5

Step-by-step explanation:

[tex]\cos X= \frac{XY}{ZX} = \frac{30}{50} = \frac{3}{5} \\ [/tex]

Answer Link

Otras preguntas

A crystalline substance that contains water
A Newton is 1 kgm/s2 . Is this a fundamental unit or a derived unit?
Jessica took a Mylar balloon outside on a very hot day. As she waited for the bus the balloon began to get bigger. What is the best explanation of this ?
What is the Pythagorean Theorem?
Show me how to solve 384÷55
This is a compound sentence: The girl ran to the store, opened the door, and rushed in to buy supplies. Question 4 options: A: True B: False
5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
the microscope most commonly used for cell study is called the
me _________ Las frutas
Nathan finds a backpack at kitt’s that is regularly $84.99,but is on sale for 1/3 off.the same backpack is regularly 72.99 at rec plus but is on sale for 25% of