Thecrazypotato12 Thecrazypotato12

07-10-2020
Mathematics

contestada

If I have a garden that's ten yards and I want to plant a plant that requires 2 yards how many plants can I plant

Respuesta :

Аноним Аноним

07-10-2020

Pretty sure it's 5. 5X2=10. Sooo

Answer Link

Otras preguntas

Paraquat is a general herbicide that kills most types of plants. in a population of ferns, it was found that 40% of the gametophytes showed resistance to paraqu

8. Bottle-propping should be avoided because A. it prevents bonding between baby and caregiver. B. some babies don't like it. C. it can cause indigestion. D. it

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

The major purpose of the passage of the north american free trade agreement was to:

Every time gabe saw his dad walk into the house, gabe would tell him about his school day. gabe's dad functioned as a(n) ______ because when he arrived, gabe ta

If it takes for men six hours to repair a road how long will it take three men to do the job if they work at the same rate?

Read the passage. (1) William Shakespeare was born in 1564 in Stratford-upon-Avon. (2) It is a town in England. (3) He is believed to have attended the King’s N

I NEED HELP ASAP!!! ISMENE: So I'll ask those underground for pardon— since I'm being compelled, I will obey those in control. That's what I'm forced to do.

Three tables are placed side by side by side. One table is 3 feet 11 inches wide, another is 6 feet 10 inches wide, and the third is 3 feet 7 inches wide. How w

PLEASE CHECK it... Write an invitation to your Christmas party you are having at your house. Use vocabulary studied in this module; explain what is going to hap