jasminet2394 jasminet2394

09-10-2020
English

contestada

Quick!! What are the conjunctions in the sentance "Although I like popcorn the best, my sister likes chips"???????!!!!!!!

Respuesta :

sailorsylvt sailorsylvt

09-10-2020

Answer:

the conjunction is although

Explanation:

Answer Link

Otras preguntas

Using the data in appendix 4,determine the standard Gibbs free energy in kj for the reaction 2Al(s)+Fe2O3(s)->Al2O3(s)+2Fe(s) in kj.

A relation R on the set of complex numbers is defined by z1Rz2 if and oly if z1−z2/z1+z2 is real Show that R is an equivalence relation.A. R is reflexiveB. R is

Find the missing terms in multiple of 3: 3, 6, 9, __, 15 Naughty boys add my in sta : miyagimugleris DM ME

Which of the following are acceptable reasons for an employer to terminate a qualified retirement plan? a) Employee requests b) Company bankruptcy c) Change in

What element has 18 core electrons and 6 valence electrons?

Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA

Which of the following group of elements present the less "Metallic character"? Ti, Fe, K, Zn, Ca, Ni a. K b. Cac. Ni d. Zn

Your school is 600 meters away from your home. Your walking speed is 200 meters per minutes. One day you set out from your home and walk to school. After a few

If 250 ml of 0.25 M NaCl solution is diluted with water to a volume of 500 ml, the new concentration of solution is:O 0.167MO 0.0167MO 0.0833MO 0.125M

Which is the currency conversion for which the pivot currency and reporting currency are the same? 1) -to-one 2) -many