Seudónimo Seudónimo

09-11-2020
Mathematics

contestada

There are 24 balls in gym class. The ratio of basketballs to soccer balls is 2:4. How many basketballs are there? How many soccer balls are there?

Respuesta :

fatima4659 fatima4659

09-11-2020

there is 24 basketballs and 48 soccer balls

Answer Link

Otras preguntas

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

Giacomo uses cocaine. he finds that he needs a line or two to re-create the original effects of a "bump." which is the most specific term describing giacomo's e

What are the two ways to properly cite sources when using MLA style? A. In-text citations and footnotes B. A works cited page and footnotes C. A works cited p

What is activation energy? A. energy needed by the body to stay active B. energy needed to break chemical bonds C. energy provided by carbohydrate foods D. ener

which of the following is the most accurate statement about poetry

Using known taylor series, find the first four nonzero terms of the taylor series about 0 for the function. sqrt((1 + t))sin(t)

The intensity of the sun's radiation incident upon the earth is about i=1.4kw/m2. suppose this is the value for the intensity of sunlight incident upon the sate

Please help will give brainlest! #1 thank you

Help me please also thanks for the help

im confused on this please help