Caliyahb729 Caliyahb729

11-11-2020
Law

contestada

If you have a captain and his name is Mr. Crunch, would you end up calling him captain crunch?

Respuesta :

leechengai leechengai

11-11-2020

Answer:

Yes.

Explanation:

Because he is a captain.

Answer Link

jacksonkids2116 jacksonkids2116

11-11-2020

Answer:Yes it would turn from Mr.crunch to CAPTAIN CRUNCH!

Explanation:

Answer Link

Otras preguntas

if anyone watches voltron i need help figuring out the color scheme (like analogous or complementary) of my drawing for art class go check out my most recent qu

1.Completa la oración con el imperfecto. ¿____________ un instrumento cuando eras niño? (play an instrument) 2.Completa la oración con el imperfecto. ¿______

drew and Evelyn measured the wingspans of their butterflies. How do the wingspans compare? theirs a monarch butterfly and a swallowtail butterfly.

Write 25.74 in word form

Choose the correct names for the car symbols shown in this picture. A. Low beam; safety belt B. Low beam; head restraint system C. High beam; safety belt

mid-ocean ridges are underwater mountainous regions formed by the separation of

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

choose an appropriate metric unit for the height of a giraffe

write two thousand five hundred thirty two ten thousandths in number standard form

What is the simplified form of 4z^2 plus 16z plus 15