ricorico01 ricorico01

11-11-2020
Biology

contestada

What is the allele number for the following sequence? (3pts)
GTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCA

Respuesta :

stefftagalilong stefftagalilong

19-11-2020

Answer:

what I don't understand what is the Ctcagt

Answer Link

Otras preguntas

Which part of speech is not appropriate in formal writing, but often used in daily conversation? a. Conjunction b. Preposition c. Interjection d. Adverb

During the War of 1812 against the British, the British humiliated America by a. overthrowing President Madison. b. forcing American soldiers into slavery. c. c

Through which of the following did Indian culture spread under the Gupta empire? a. trade b. invasion c. Literature d. Religion

Which one of the following sentences contains an incorrect usage of the singular possessive? a. Mary was dominant among Jesus disciples b. lcaru's fate was seal

Why did some Americans want the United States to help Cuban revolutionaries fight against Spain in the late 1890s? a. Americans were afraid the United States co

Why did government officials allow monopolies to operate without strong regulations during the gilded age? a. They believed monopolies would keep competiton al

Which of the following would be the most reliable source to consult when creating a healthy weight loss plan? a. A how-to article in a fitness magazine b. A sam

what is one way local governments are similar to federal government's

Ideally, an “Enlightened Monarch” would _______________________________ . a. promote cultural change within colonized areas c. rule through divine inspiration b

why was it important to the people of sumer that trade developed early?