jls7281 jls7281

08-01-2021
Biology

contestada

TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA

Respuesta :

mathsbeginer mathsbeginer

12-01-2021

Answer:

I don't know the answer

Explanation:

is is this even a question cos I don't think so.

Answer Link

Otras preguntas

Which adjective best describes the theocracy of Iran? representative restrictive militaristic expansionist

Healthcare providers who organize to treat Medicare patients are called _______ organizations.

How did Germany feel about the Triple Entente?

Has the Scientific Revolution ended?

Which expression is equivalent to 5x + 7y?

Six houses are located along the same road; the distances are shown. Where should the school bus stop to make the sum of distances from every house to the stop

Carol makes 9 1/3 Cups of snacks mix. She puts all the snack mix into plastic bags. She puts 2/3 cup of the snack mix in each bag. How many Plastic bags does ca

How did the Supreme Court define the role of the federal government in Marbury v. Madison (1803) and McCulloch v. Maryland (1819)? Identify at least two exampl

Bo3 how to beat kino der toten remake

If you want to look out all light , how should you arrange two polarizing filters