Ravenlyn8 Ravenlyn8

06-02-2021
Social Studies

contestada

Warm-Up
Select the correct answer.

What is the difference between Climate and weather if you're not sure take a
guess

Weather is the short-term atmospheric conditions in a region. Climate is the long term acrospheric conditions in a region.

Weather is the long term atmospheric conditions in a region. Climate is the short-term atmospheric conditions in a region

Weather is the differences in atmospheric conditions from region to region. Climate is the average global atmospheric conditions.

Climate is the differences in atmospheric conditions from region to region. Weather is the average global atmospheric conditions.

Respuesta :

karinauwase karinauwase

06-02-2021

Answer:

Weather reflects short-term conditions of the atmosphere while climate is the average daily weather for an extended period of time at a certain location.

Explanation:

Answer Link

Otras preguntas

We are interested in the dimensions of a certain square a rectangle had length triple the side of this square and width two units less than the side of this squ

Phospholipases are enzymes that do which of the following? degrade antibodies promote pathogen spread through connective tissue. degrade nucleic acid to promote

Saturday morning there were 7 adults and 20 kids at Pump and Jump Land. The morning cash registers show $236 was collected. In the afternoon there were 21 adult

A fixed asset with a five-year estimated useful life and no scrap value is sold at the end of the second year of its useful life. How would using the straight-l

Which of the following are found both in the auditory system and the vestibular system? basilar membrane hair cells semicircular canals ossicles

How do arteries differ from veins? Arteries have thicker wall layers to accommodate the changes in pressure from the heart. Arteries carry blood. Arteries have

A 28-year-old man presents with complaints of diarrhea, fecal urgency, and weight loss. His stool is light colored and malodorous, and it tends to float and be

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

Both Apple and Nike produce their products and own retail outlets. They also rely on independent distributors to sell their offerings. Apple and Nike are utiliz

Practice entering numbers that include a power of 10 by entering the diameter of a hydrogen atom in its ground state, dH=1.06×10−10m, into the answer box. Expre