t0x1cv3n0m2007 t0x1cv3n0m2007

09-04-2021
Geography

contestada

Help pls i dont have time 25. What is the average rainfall for each ecoregion?
26. Based on the highest part of the rainfall average for the ecoregions, which 4 ecoregions
had the highest amount of rain?

Help pls i dont have time 25 What is the average rainfall for each ecoregion 26 Based on the highest part of the rainfall average for the ecoregions which 4 eco class=

Respuesta :

shahandadabber shahandadabber

16-04-2021

Answer:

its c because 7 x 9=90+7=900

Explanation:

your welcome man

Answer Link

Otras preguntas

nine less than the product of a number and -4 is 35

Which of the following is not a feature of a good summary? Brief Objective Restates the thesis Focuses on minor details

Can I get some help? Please show your work! Thanks!

Select the equation that contains the point (3, 6) and in which the slope equals 1. A. y + 6 = x + 3 B. y - 6 = x - 3 C. y + 6 = 3x D. y - 6 = -3x

NEED HELP IN THIS QUESTION ASAP, WILL GIVE BRAINLIEST ANSWER Find the remainder when f(x) is divided by (x - k). f(x) = 7x4 + 12x3 + 6x2 - 5x + 16; k = 3 (1 poi

The united states wishes to import no more than 100 million tons of sugar from india in any given year. the type of import restriction it should impose is a(n)

If a user would like to modify margins to specific settings, users would need to select the _____ option.

What political, economic, and social changes resulted from Japan’s unification during the late sixteenth century?

To which of the following DNA sequences would the TATA box binding protein bind? A. TAGGCGTATATAGCGCCTTAT B. CCCGTTAATTAATTAACGCGC C. GCGCTTATCTATTACCGTACG D

A body is accelerated continuously. What is the form of the graph?