RamenDonkey
RamenDonkey RamenDonkey
  • 14-04-2021
  • Biology
contestada

what is the complementary DNA of TACCGGATGCCAGATCAAATC?

Respuesta :

addysenseheult addysenseheult
  • 14-04-2021

Answer:

ATGGCCTACGGTCTAGTTTAG

Explanation:

A=T

C=G

G=C

T=A

This is the key to finding a complementary DNA strand.

Answer Link

Otras preguntas

Which of these African-American inventors developed a shoe-manufacturing machine that significantly cut shoe prices in the United States?
what to multiply 36 2/5 to get 109 1/5
If the sum of the legs of a right triangle is 49 inches and the hypotenuse is 41 inches, find the length of the other two sides
Which of the following statements best describes the Lend-Lease program initiated by the United States during the early part of World War II? a) Foreign nations
What is the product in lowest terms? 8/15 * -3/10 A. -4/25 B.-3/35 C.-2/25 D. 1/5
What 3 ideas made up the new learning in the Renaissance?
do you think the framers created an effective form of government
Which statements about American involvement in Vietnam are true? Choose all answers that are correct. A. Presidential advisors urged both Kennedy and Johnson n
5x^2+20=30 please show all work
what is 2 7/12 - 5/12