RamenDonkey RamenDonkey

14-04-2021
Biology

contestada

what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAACCACAACT and TACCTGTTAAGCTACAAAATT?

Respuesta :

officialscripture officialscripture

14-04-2021

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

Answer Link

Otras preguntas

Please help me ASAP!! #1-20 both pages please, thanks!!! :D

The extra amount of satisfaction that you receive from an additional slice of pizza is part of the _____ . marginal benefit marginal cost marginal revenue

what are the items that traveled between Europe and the Americas as part of the Columbian exchange

Cone-bearing trees (like pines, spruce and fir) grow best in areas where winters are long and cold. Large mammals like moose, elk and bear also live and thrive

The Crusades created a demand for goods among the people. true or false?

during the boycotts of jewish merchants, who would greet you at the door to tell you his business was owned by jews?

The kinetic energy of all the particles in a given sample of matter is the same. a. True b. False

Smooth muscles are found in all of the internal organs except what?

One of the causes of World War I was imperialism. Imperialism is the system of taking control of many nations. Which of these is an example of imperialism that

A positive incentive that makes you better off is a _____. value penalty reward