Below is a segment of DNA. Assume the promoter is on the left. Transcribe and translate the DNA into a polypeptide.

5’-TATGATGCCACCATGGACTCGATCCCCTCATAAACATCGG-3’

3’-ATACTACGGTGGTACCTGAGCTAGGGGAGTATTTGTAGCC-5’

Report the polypeptide sequence using the three letter amino acid code and separate each amino acid with a dash "-" mark. Example: If an answer was three amino acids of lysine, lysine, glycine, then the answer would be reported as: Lys-Lys-Gly. Spelling and appropriate capitalization of the three letter amino acid code counts

Below is a segment of DNA Assume the promoter is on the left Transcribe and translate the DNA into a polypeptide 5TATGATGCCACCATGGACTCGATCCCCTCATAAACATCGG3 3ATA class=