08-12-2016
Mathematics

contestada

What is 15% of 34
Please explain

Respuesta :

cbleachdab cbleachdab

08-12-2016

5.1 bc .15 (15%) times 34 is 5.1

Answer Link

Otras preguntas

what is the ionic equation for HBr(aq) + NH3(aq)

What color does cobalt-oxide produce? a. blue-violet b. red c. yellow d. green

If you have a long title for a table and need it to span several cells you use

The best determinant of how an individual measures their quality of life is _______. a. family and friends b. education c. culture d. demographics

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the

Which of the following describes a similarity between fascism and communism during the 1930s? A. Both ideologies required governments to create command

How do I find the potential difference across and what formula should I use to find the Power?

ABCD is a square, what is the measure angle of BAC

Which word in the sentence is an example of a common noun? Weathering Heights and the call of the wild are two of my favorite books. A. books B. favorite C. are

Can someone answer this for me (number 7 with quadratic equations algebraically)