Mredoux2019 Mredoux2019

09-06-2021
Mathematics

contestada

PLEASE HELP ME QUICKLY!!!!!

Find the equation of the line of best fit in slope-intercept form.

PLEASE HELP ME QUICKLY Find the equation of the line of best fit in slopeintercept form class=

Respuesta :

09-06-2021

y=2/5+3; u gotta find two points, count the rise over run and find the y-intercept

Answer Link

Otras preguntas

PLEASE HELP, TIMED FINAL The first three steps in determining the solution set of the system of equations, y = –x2 – 2x + 8 and y = 2x + 11, algebraically are s

Leadership in House committee is decided primary by

Which government function would not be provided by a county government

How does the narrator feel immediately after he commits the murder? Do his feelings change? If so, how and why in Tell-Tale Heart

5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand

If you disagree with a point a discussion partner is making , it is usually a good idea to

Which of the following angles is coterminal with 400°?

HELP. NOW!!!!!!! According to anthropologists, why did people moved to the Northern Nile River?

please help me on question 12. My substitute teacher didn't know how to do this problem so I'm asking you kind people to help me

A gym charges $50 dollars per month after an initial membership fee. A member has paid a total of $320 after 6 months. Write an equation that gives the total co