justtellmetf justtellmetf

10-06-2021
History

contestada

Ancient Sparta was a Greek city-state that featured a democracy as its central form of government.

True or False?

Respuesta :

jonah89 jonah89

10-06-2021

True, it is a Greek city -state located primarily in the present-day region of southern Greece called Laconia.

Answer Link

Otras preguntas

11499 round to the nearest thousand

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

HISTORY HELP !!!Question 1 What was America concerned would happen if Vietnam became communist? Question 1 options: That it's neighboring countries would also

Question 10 unsaved in a chemical reaction, the mass of the products question 10 options: has no relationship to the mass of the reactants. is less than the mas

Zoologists are studying two newly discovered species of insects in a previously unexplored section of rain forest. They estimate the current population of insec

I need a poem about cyber bullying and include metaphor, simile, etc

What is the slope of the line shown on the graph?

Find the slope of the line through the points (-4,6) and (8,4). A.) -5/6 B.) -1/6 C.) -3/2 D.) -1/2

How where Katherine, Mary, Dorothy, and their coworkers challenged by discrimination? How did they succeeded anyway? Hidden figures the movie.

which of the following is not an authoritarian form of government ? A. Dictatorship B. Direct democracy C. Totalitarianism D. Absolute monarchy