paige57012 paige57012 15-06-2021 Biology contestada 1. Given the double-stranded stretch of DNA below, determine the base sequence of messenger RNA strand produced using this gene as the template. *Hint: Only one of the two strands is used as the template. 5'ATGCCATTGCTTAAGCGGGCATTATATCCAAGA 3' 3' TACGGTAACG AATTCGCCCGTAAT ATĄGGTACT 5 AUGCCAUUGCUU AAG-CGG-GCAULAUAU CCA UGA How many amino acids will this protein contain?