junie46 junie46

06-08-2021
Mathematics

contestada

Which of the following equations is an example of inverse variation between
the variables x and y?

Which of the following equations is an example of inverse variation between the variables x and y class=

Respuesta :

Аноним Аноним

06-08-2021

Answer:

B

Step-by-step explanation:

Any inversely proportional equation is of the form y=k/x.

Answer Link

balabedali939816 balabedali939816

24-02-2022

Answer:

Step-by-step explanation:

B

Answer Link

Otras preguntas

Another characteristic that you want to include in the introduction is bacterial reproduction. Prokaryotic cells have only one chromosome and lack any organelle

Heat and redness, or ________, occur when the small blood vessels in an inflamed area dilate (open up), bringing more blood much closer to the surface of the sk

Identify the volume of the composite figure. Round to the nearest tenth. Help please

refers to a loss of blood pressure resulting from a system-wide infection.

A batch of food contaminated with botulism exotoxin, consumed at a family reunion by most of the members of a family, would be an example of a ________ outbreak

Which one of the following statements concerning the economic order quantity (EOQ) model is TRUE? An increase in holding cost will increase the EOQ. A decrease

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

1. Se veían se ayudaban se besaban 2. Samuel y Andrea ____ por la amistad (friendship) de sus madres. se escribían se entendían se conocieron 3. Las madres de A

The flexibility of a joint is affected by its structure, the nature of the surrounding tissue, and muscle elasticity and length. True False

Name a point NOT contained in lines m, n, or p. A) plane K B) A C) D D) H