275832
275832 275832
  • 06-12-2021
  • Biology
contestada

What do convection currents mean?

Respuesta :

arden0919 arden0919
  • 06-12-2021

Answer:

Convection currents transfer heat from one place to another by mass motion of a fluid such as water, air or molten rock.

Explanation:

Answer Link

Otras preguntas

Which statements correctly describe Washington dc check all that apply
Describe three characteristics that designate the United States as an independent state
In 1947, the peak year of the GI Bill, forty-nine percent of a homeowners b. college students c. business owners d. unemployed Americans
What do religious creationists believe?
An example of an animal with RADIAL symmetry would be a ladybug is it true or false
Scientists predicted that the zebra mussel would arrive in the Hudson River. What evidence supported their prediction? (A) Zebra mussels were in the Great Lakes
Plants and other producers make their food using photosynthesis True False
if an integer from 3 through 14 is chosen at random, what is the probability that the number chosen is NOT prime
Mortenson Corporation sells its product, a rare metal, in a controlled market with a quoted price applicable to all quantities. The total cost of 5,000 pounds o
How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG