chriswhelan chriswhelan

09-12-2021
Business

contestada

The number of textile and agricultural jobs in NC have decreased due to:

Respuesta :

raymondandliena raymondandliena

09-12-2021

Answer:

hiiiii

Explanation:

Answer Link

razersynapsefr37 razersynapsefr37

09-12-2021

Pew pew pew pew pew Pew pew pew pew pew

Answer Link

Otras preguntas

What year did Stephen Hawking Die?

Plant needles are PROBABLY initially the result of A) adaptations for survival that some plants developed due to high temperatures on Earth. B) somatic mutati

Roland had S10,500 in medical expenses last year and has no medical insurance. The IRS allows medical expense deductions for the amount that exceeds 75% of a ta

A metronome uses a pendulum to keep time. The table gives the angular displacement of a pendulum as it swings back and forth. What is the period of its oscillat

One reason the cultures of north africa developed differently from the cultures of the rest of africa was that these areas of africa were separated by the a.ara

Do you think it was moral for European nations to claim lands in the Americas that were already inhabited by natives? Why or why not?

Find the perimeter of the rectangle. If the rectangle has vertices M(−2,4), N(1,5), O(3,−1), and P(0,−2), what is the perimeter of the rectangle? Round each sid

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

Ofelia / y / claudia / encantar / manejar / los carros / suyo tú / no / deber / leer / los mensajes / mío ¿por qué / tu padre / ir / a / vender / la computadora

What sentence best expresses the central argument of president Barack Obama’s back to school speech?