skhallskidz skhallskidz

09-05-2022
Biology

contestada

What is the correct numerical sequence for unlocking "DNA Structure?"

Respuesta :

howardclemingtime howardclemingtime

09-05-2022

Answer:

3'TGACGACTACAACTTAATCT

Explanation:

Adenine bonds with thymine; guanine bonds with cytosine. This is the complement DNA sequence.

Answer Link

Otras preguntas

Solve for x as well as rounding to nearest tenth please<3

QUESTION 4 Click here to read the passage before answering the question. Read this sentence from paragraph 7 of the passage. The brand flashes on the screen or

when there is 3pm at 150° east longitude,what will be the present time at kathmandu 85°?

Find the measure of the angles. 3 62 mZ1 = mZ2 =

What did Hayes promise during his campaign in the election of 1876? o to allow the southern states to have self-government O to protect African American rights

If 25.0 g NO are produced, how many grams of nitrogen gas are used? A: 5.84 g B: 11.7 g C: 23.3 g D: 33.6 g

What is the domain and range? what type of relation is this

How many intrusion switches are there in Dell Precision Tower 7920?

How many clauses does each of these sentences have: 3) I will be here until Wednesday. 4) If you proofread carefully, your final draft will improve. 5) I read t

9. In a neutralization reaction, an acid and a base react to produce a an oxide and water.true/false