mnakamoto mnakamoto

12-02-2017
Business

contestada

Economics concerns the allocation of resources for which processes?
a. production and distribution
b. consumption and destruction
c. innovation and efficiency
d. expansion and stagnation

Respuesta :

20-09-2017

Production and Distribution. Economics is concerned with how to produce goods and services using limited resources, and most efficiently distribute these products to maximize the benefit of everyone.

Answer Link

Otras preguntas

Which of the following have one solution, solve for brainly :P

The lifetime of a certain brand of battery is known to have a standard deviation of 9 hours. Suppose that a random sample of 150 such batteries has a mean lifet

5 6 Harder Questions 3 4 Question Progress b) nth term: 87% The terms in this sequence increase by the same amount each time. 19 34 a) Work out the missing term

Scenario: You took your little brother to Chuck E Cheese during the Winter Break. While you were there, there was a group of teenagers running around, play figh

A company had total liabilities of $275,000 and the owner’s equity was $1,722,000. According to the fundamental accounting equation, total assets must be:

pls help me im bad in reading !!!

06:02 MC) An automobile company is building a new factory in your town. What may be a positive externality of this event? (1 point) a Noise produced by the wor

TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.

Find the probability that a point choseb at randon the figure will lie in the shaded region. Write your anser as a percentage rounding to the nearest hundreth i

A tower that is 103 feet tall casts a shadow 117 feet long. Find the angle of elevation of the sun to the nearest degree