MartinGarrixFan MartinGarrixFan

07-06-2017
Mathematics

contestada

The square root of a number is between 10 and 11. Which of these could be that number?

A) 105

B) 83

C) 95

Respuesta :

cutiebanhof cutiebanhof

07-06-2017

The answer is A: 105.

Answer Link

Mcalister22 Mcalister22

07-06-2017

The answer is A-105. I really think.

Answer Link

Otras preguntas

Solve the recurrence relation for the variables indicated below: bn = 8bn-1 - 15bn-2 b1 = 2 b2 = 16 If the explicit formula for the sequence is wr

Which of the following is NOT true about the Gettysburg Address? A. It eloquently made the point that the dead should not have died in vain. B. It contains the

What are the four components necessary for a plant to perform photosynthesis? a.chloroplasts, sunlight, carbon dioxide, and water b. ribosomes, seasons, carbon

Yasmine needs to create invitations for the party. She has 3/4 of an hour to make the invitations. It takes her 1/12 of an hour to make each card. How many invi

write an equation in standard form passing through points (-2,0) and (-3,-1)

Find the simple interest earned to the nearest cent for each principal, interest rate, and time. $1,200, 3.9%, 8 months

Ofelia / y / claudia / encantar / manejar / los carros / suyo tú / no / deber / leer / los mensajes / mío ¿por qué / tu padre / ir / a / vender / la computadora

2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the mRNA of the

Modern Appliances offers a one-year monthly installment plan for a refrigerator. The payment for the first month is $75, and then it increases by 6% each month

Find the value of the combination. 8 C 6 336 56 28