dillonfrederick dillonfrederick

09-06-2017
Biology

contestada

the study of living things and surrounding abiotic environment is known as

Respuesta :

09-06-2017

The study of living things and it's surrounding abiotic environment is known as ecology.

Answer Link

rlw11362 rlw11362

29-10-2020

Answer:

Ecology

Explanation:

Answer Link

Otras preguntas

Western Hatcheries Limited has market value of equity of $60 million and market value of debt of $40 million. The firm has $100 million worth of total assets. T

Of the DNA sequences below, which would probably be the harder to determine? a) CGATATATATATATACGATGGCATCACGAGCTGCATTCGCA b) CGATATATATATATACGATGGCATCACGAGCTGCA

What is the equation of the line? Question 1 options:

According to chapter 16 of Pride and Prejudice, what does it hurt Mr. Wickham to do? OA. Leave Elizabeth's side B. Talk poorly about a Darcy C. See Mr. Darcy un

Transmembrane proteins span the width of cell membranes. Four types of transmembrane proteins are shown in a section of cell membrane.

The structure of a peptide is given below If the absolute values of the net charge of the peptide at pH = 2, pH = 6, and pH = 11 are |z1|,|z2| and |z3| , respec

To remember a list of the school supplies she needs, Marcy mentally visualizes each item at a certain location in her house. Marcy's tactic best illustrates the

Which of the following buddhist sites in india are also the unesco world heritage sites? 1. ellora caves 2. ajanta caves 3. elephanta caves 4. mahabodhi temple

On a particular college campus, 33% of the students belong to a fraternity or sorority. If 61 college students are randomly chosen: a) Approximately 20 students

Considering a 3D model of a generic molecule, how can we determine which atoms occupy the axial and equatorial positions?