AddieBffMaddie9748 AddieBffMaddie9748

06-10-2017
Business

contestada

Brenda is an electrician with bright light home and business. into which category of job does she best fit

Respuesta :

ModernPrincess ModernPrincess

08-10-2017

isn't she an electrician? Please explain question more

Answer Link

Otras preguntas

can anyone help me with these? I'm having a lot of trouble and I'm extremely behind... I need to catch up badly!!! i have been at the hospital and have missed a

Which word would CHANGE the meaning of the selection above if it replaced "variations"? A differences B changes C shifts D bends

50 points! Show your work!

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is

Jackrabbits are capable of reaching speeds up to 40 miles per hour. How fast is this in feet per second? (Round to the nearest whole number.) 5,280 f

which describes the current model of the atom? a. it can be used to predict atomic behavior in most circumstances. b. it has been perfected and will never be ch

Why is a parent usually a better match for transplanted tissue to a donor than a random individual of the same species?

Describe two ways that decreasing temperature would affect the rate of diffusion of molecules across a cellâ€™s plasma membrane.

Many people use antimicrobial soap to kill bacteria on their hands. However, overuse may actually increase the risk of infection. How could this occur?

A circular coil with 600 turns has a radius of 15 cm. The coil is rotating about an axis perpendicular to a magnetic field of 0.020 T. If the maximum induced em