MrsMintyMoose MrsMintyMoose

08-10-2015
Social Studies

contestada

Which of the following best describes the settlement of San Miguel de Gualdape?
A. It was the first European settlement in South Carolina. B.It was the first settlement in South Carolina to have 1000 residents. C.It was started by the French on Parris Island. D.It was built by the English near Charleston.

Respuesta :

Аноним Аноним

08-10-2015

i think C sound the best to me but what do u think

Answer Link

Otras preguntas

What’s the correct answer for this?

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

what is an artist because I want to know what is an artist

What is one way to organize ideas in a clear and concise manner

What type of figurative language is used in the line "one single streak of gold from yonder clouds," and what is its effect? It is a metaphor that compares sunl

what is the measurement of RST A: 40° B: 50° C: 60° D: 70°

A mechanic is using a machine that makes metal parts. She measures each part to confirm it is the correct size. Negative numbers mean the part is too small, and

what is a 5 letter word that if u take out the remaining last 4 letters, it will still be pronounced the same?

The United Nations passed a __________ that split Palestine into __________. A. resolution . . . two states B. constitution . . . three states C. law . . . two

4 cm 8.5 cm What’s the area ?