mjcally03 mjcally03

07-11-2017
Mathematics

contestada

Which set of numbers could represent the lengths of the sides of a right triangle? A 8 9 10 B 2 3 4 C 12 15 20 D 9 40 45

Respuesta :

Redneck001 Redneck001

07-11-2017

id say b because hypotenuse is bigger than length and width

Answer Link

Marigolden Marigolden

19-03-2020

Answer:

I took this test and for D. I think you meant to put 9, 40, 41 which is the correct answer.

Step-by-step explanation:

Answer Link

Otras preguntas

Please Help!!!!!! So i know how to reflect over line y=-x but how would i do it over line y=-x+6. An example would be helpful and a rule for more problems of th

In the reaction C + O2 → CO2, 18 g of carbon react with oxygen to produce 72 g of carbon dioxide. What mass of oxygen would be needed in the reaction? 1.) 18 g

Can someone tell me if I got this answer correct? If not, what is the correct answer?

At willow creek middle school, 1 out of every 8 students signed up for band. If there was 400 students at the school, how many signed up for band?

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

how is a circle different from an ellipse

Light goes from flint glass into ethanol. the angle of refraction in the ethanol is 25.6 ◦ , the index of refraction for flint glass is 1.61, and the index of r

Which quotation from a history of the world In 100 objects best reveals the historical significance of the chronometer

Find the nth term of the sequence, then find the 20th term, 100th term and the series for each? 2/5, 1/15, -4/15,....

The __________ of the earth does not transmit s waves.