muskansingh44p566uj muskansingh44p566uj

06-03-2018
Chemistry

contestada

six fingered offsprings are formed from normal fngered parents.why?

Respuesta :

acidxfairy acidxfairy

06-03-2018

It's a Recessive trait

Answer Link

Otras preguntas

According to the chart, which country's HDI has improved the most since 1995?

ok, my let’s try this again. can someone please help fill out the ? for this table.

Can you have two communities with different species richness but the same species evenness? If your answer is yes, please give an example to illustrate what thi

aerobic exercise uses oxygen, typically involves using large muscle groups during continuous activities, and promotes cardiovascular health.

mince pies and 2 jars of cranberry sauce costs £4.80 10 mince pies and 3 jars of cranberry sauce costs £7.60 How much does a mince pie and a jar of cranberry sa

is it better for our economy to allow free market forces to govern our financial services or should there be more regulation by the federal government and the f

What type of symmetry does xy = 7 have?

which defense mechanism is being used when a student decides not to think about a parent's illness but to rather concentrate on studying for an upcoming test

which of the following is an example of avolition? group of answer choices lack of motivation to bathe yourself lack of interest in going out with your friend

our sequence is 5' - cttataaagccgtacaaaatctttctagcgcaaaa - 3'. for simplicity sake, only consider the 5' to 3' direction. consider the underlined c. would a cha