ghicks5643 ghicks5643
  • 09-03-2018
  • English
contestada

What does Odysseus do on the island of Cicones that best shows the trait of leadership?

Medal ; This is from the Myth "The Odyssey",

Respuesta :

W0lf93
W0lf93 W0lf93
  • 17-03-2018
After Odysseus and his men landed on the island and plunder for goods, Odysseus commands then to untie him when he hears the sirens and he then passes Circe's counsel on to his men.
Answer Link

Otras preguntas

Help question 7 pleaseeeee Brainliest
what is the image of point 0,6 after a dilation of 1/3
An object that sinks in water has a mass in air of 0.0675 kg. Its apparent mass when submerged in water is 0.0424 kg. What is the specific gravity SG of the obj
Explain how increasing the coefficient of x affects the graph of
point e is the midpoint of ca and bd. which statements about the diagram are true?
2 1/3 - (-5) = what does it equal
:3333333333333333333333
You are given the following DNA sequence and have determined that it is the sense parental strand. ATTGCCATGAAACGCCCCGGTACACCATTGTTCGGCAAATAAAAATAA Wha
Help!!!! please help me !!!!!!
Which of the following was the origin of today's marathons? the announcement of the Athenian defeat at the Battle of Marathon the announcement of the Athenian