Dennyclark971 Dennyclark971

06-04-2018
Biology

contestada

The ovum does not complete meiosis ii until after fertilization

Respuesta :

jesslevy jesslevy

06-04-2018

True , hope this helps

Answer Link

Otras preguntas

What is the slope of the line whose equation is 12=4x-6y?

In the absence of carbon dioxide in its environment, the plant will a. be able to use alternate pathways to produce carbohydrates b. be able to use water vapor

Read this excerpt from White Fang. At last [White Fang's] nose touched the canvas. He waited. Nothing happened. Then he smelled the strange fabric, saturated wi

The most important industry in the Caribbean is __________. A. aircraft manufacturing B. coffee farming C. tourism D. oil production

volcano under the city summary

One theme of “Gumption" is that people tend to lose hope in difficult times. How does Sylvester help to develop this theme? A. He makes fun of those around him

Given the sequence ATGGCGAATCACGTCACTTGA a) Write the sequence of nucleotides for the complementary strand of DNA. b) Write the mRNA sequence transcribed from t

If a number is divisible by 10, then its ones digit is 0 TRUE OR FALSE

Correct this sentence... You are so kind, I will help you.

Help me ASAP for 3 questions! (Questions are about the 13 Colonies) 1) Describe what the southern economies were based on. 2) Describe why the New England colo