kbkbkbkb4131 kbkbkbkb4131

08-04-2018
Biology

contestada

What organ so the fluids made by the pancreas protect?

Respuesta :

tmiles004 tmiles004

08-04-2018

it's the small intestine that the pancreas protect

Answer Link

Otras preguntas

A box contains 5 purple marbles, 3 green marbles, and 2 orange marbles. Two consecutive draws are made from the box without placement of the first draw. Find th

How many moles of sodium acetate (nach3coo) must be added to 1.000 liter of a 0.500 m solution of acetic acid (ch3cooh) to produce a ph of 5.675? the ionization

When Greg was born, his grandmother put $5000 in a savings account for his college expenses. It was compounded at 2.5 percent semiannually, and left in the acco

Why have we not found examples in the fossil record of every animal that ever lived on earth? select all that apply. select all that apply. many fossils remain

1. Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’

which phrase correctly completes this sentence? La bailarina levanta los brazos y esta ______. memorizando los dialogos bailando en putillas preparando la ilum

HELP ASAP PLS Solve and check c-4/c-2=c-2/c+2-1/2-c the solution is c = ? How many extraneous solutions are there?

help me solve -2(-9m-2)-1=27+10m

An angle with a measure of 180 degrees is formed by two opposite rays. True False

which practice should an obese individual on a diet carry out