Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg?

Question

06-05-2018
Biology

contestada

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? view available hint(s) where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3')? it would not bind the target dna. ttttagccatttacgattaatcg ttttagccatttacgattaatcg ttttagccatttacgattaatcg?

Respuesta :

Otras preguntas

Latoya received a $ 70 gift card for a coffee store. She used it in buying some coffee that cost $ 8.13 per pound. After buying the coffee, she had $ 45.61 l

What was Hurst Nation

Eleven soccer players wish to form a team consisting of 3 forwards, 3 midfielders, 4 defenders and one goalie. how many possible outcomes are there?

Due to ideal growing conditions in New Zealand vineyards and an overabundance of grapes, the price of Sauvignon Blanc wine decreases dramatically. Which of the

The vedas of the aryan people became the basis for the?

3X3X11 Write the number whose prime factorization is given

60 cans of soup are arranged to be displayed in 10 rows. Why does the fraction 10 over 60 not represent this situation? Explain.

Which of the answer choices is the correct numerical expression for the situation given below? 10 is multiplied by the sum of 3 and 2. The product is divided b

What vegetables are part of the three sisters farming? and what vegetable also helped the other vegetable?

BioWizard BioWizard · Answer 1 · 2018-05-19T19:03:52+02:00

BioWizard BioWizard

19-05-2018

If the DNA sequence is: 5’ TTTTAGCCATTTACGATTAATCG 3’
The probe 5’ AATCG 3’ will bind for the CGATT part of DNA.
The two complementary strands of DNA are usually differentiated as the "sense" strand (5’-3’) and the "antisense" strand (3’-5’), meaning that they have different directions. According to this, the probe in antisense would be 3’ GCTAA 5’.

Answer Link