princethegoat princethegoat

09-05-2018
Mathematics

contestada

Which answer choice below correctly identifies the 202nd term in the sequence 5, 10, 15, 20, 25 …?

Respuesta :

TheBusinessMan TheBusinessMan

09-05-2018

The 202nd term in the sequence is 1010.

Answer Link

Dulceherrada Dulceherrada

23-12-2020

Answer:

answer is : A. 1010

Step-by-step explanation:

Answer Link

Otras preguntas

Civil inattention appears to be a rather unconscious behavior and has several functions in our social world. Please select the reason that sociologists argue it

3x^2+x+1=0 Please show your work to see how you even solve this thanks !

What is NOT an impact that an invasive non-native species has on an ecosystem? A) change food webs B) decrease biodiversity C) prey on native species D) impr

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

Oliver is going to drive from his house to City A without stopping. Oliver plans to drive at a speed of 40 miles per hour, and after driving for 3 hours, he wi

In the formation of Earth's atmosphere throughout its history, each of the following gases have, at one time or another, been the dominant gas in the atmospher

A company had the following cash flows for the year: (a) Purchased land, $60,000 (b) Borrowed from a local bank, $100,000 (c) Paid employee salaries, $50,000 (d

What is NOT an impact that an invasive non-native species has on an ecosystem? A) change food webs B) decrease biodiversity C) prey on native species D) impr

Which influence technique involves asking for a small request in order to increase the likelihood of the target complying with a larger request later?

While creating a sketch, what helps you identify positive and negative space?help you identify positive and negative space.