dandaw0437 dandaw0437

08-10-2018
Mathematics

contestada

The length of a rectangle is 4 centimeters more than twice its width, If the perimeter of the rectangle is 86 centimeters, find the smaller of the two dimensions of the rectangle.

Respuesta :

Аноним Аноним

08-10-2018

Rectangle formula 1/2 ×b × H × l
= 1
___ × 4 × 86 × 2 = 344 totally answer
2

Answer Link

Otras preguntas

What happened to the spending habits of the people when they lost their jobs, or their friends lost their jobs ?

The questions below are true or false questions plz help me

13. Joe expects to spend at least $8500 on a used car, but he can’t afford to spend more than $12,000. Which inequality could be used to describe the amount of

A common technique in analysis of scientific data is normalization. The purpose of normalizing data is to eliminate irrelevant constants that can obscure the sa

a scientist isolates a number of non photosynthetic prokaryotes which structure would be found in theses cells

three incident which happened in your locality that did not reflect democratic norms

The need that appears at the top of Maslow's hierachy is___________

Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?

Why was Antietam a major turning point in the Civil War? A. It was the last time Confederate troops would enter Union territory B. The close victory afforded Pr

The graphic shows the island of Krakatoa, which disintegrated in 1889, due to the largest volcanic eruption in recorded history. In the century since the erup