davidlopez101802 davidlopez101802

14-11-2018
History

contestada

What were chinas main exports and imports during the tang song dynasties

Respuesta :

senetrayoung senetrayoung

14-11-2018

cotton , tea , rice , soybeans , crude oil , iron ore

Answer Link

Otras preguntas

A type of consequence commonly associated with a not engaging in appropriate professional etiquette would be __________________.

How many people are at chrissys birthday party? 22 1\2 divide 1 1/4

Click on the edit DNA, you will now see the original sequence used to make the protein. ATGCCGGGCGGCGAGAGCTTGCTAATTGGCTTATAA

On a business's income statement, inventory affects

Is the value of the first 7 ten times as great as the value of the second 7 in 7237

6. According to paragraph 6, M. Fortier is happiest

The physician orders 150 mg/5 kg. The patient’s weight is 75 kg. How many grams of medication has the physician ordered?

The principle of cause and effect is a philosophical concept that seeks to explain the relation between an event (cause) and a second event (effect). Perhaps th

From a rock ledge, the angle of elevation to the top of a tree is 22°. The angle of depression to the base of the tree is 12°. a) Find the height of the rock le

It is quite clear that the Rabb family owned slaves. Is there evidence in Rabb’s letters that he would have fought even if his family didn’t own slaves?