famon3e4graph famon3e4graph

07-04-2016
Chemistry

contestada

is it true that the formula for magnesium sulfate shows that there are four atoms of sulfur

Respuesta :

rockingholly24 rockingholly24

07-04-2016

The chemical formula for magnesium sulfate is MgSO4, so it shows that there are four atoms of oxygen but not sulfur. There is only one atom of sulfur in the formula

Answer Link

Otras preguntas

August stops by his mother april's house every week. if april has no trouble with tasks like making coffee or unloading the dishwasher, then august withdraws. a

The first step in managing it security is to develop a _____ based on confidentiality, integrity, and availability. a. risk policy b. security policy c. thr

Why do you suppose that tropical rain forests are the richest terrestrial ecosystems in terms of plant and animal diversity?

Rogers felt that it was most important for clients to gain insight about ________.

Why is satellite imagery useful to ecologists (mark all the apply)? small habitats can be observed individual high resolution of ecosystems is possible larg

who won the rumble? how was the winner determined?

Need some help on this

Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequences are always written 5' to 3

The cost to repair Linda's car is $500, including parts and labor. The cost of parts is $140. If the cost of labor is $40 per hour, how many hours of labor did

How did Willem Becnel affect America settlement in New Mexico